Validation Run of Process on Mycena leptocephala
/This was more of a quick hack at the process rather then a thoughtful well planned out process attempt as I wanted to just see if all of the equipment and sequencing service worked. This process test was run on the same day as the equipment validation run, but this post is later as I was waiting to sequencing data to return.
Sample
Since I had started a relatively robust collection of Lake Merritt's fungi last year due to the large amount of rainfall I pulled from the dry specimens a collection with lots of fruiting bodies that I also know occurs every year so that if the process didn't turn out data there is nothing lost. The chosen specimen is collection 5036264 which is presumabely Mycena leptocephala; a wood chip loving mushroom with the common name Nitrous Bonnet due to its pungent odor when crushed. I use the iNaturalist unique ID in the collection as a unique identifier on all containers of the specimen. Below are the images from the iNaturalist observation.
Processing - DNA Extraction, PCR, Gel Electrophoresis
Processing took place on my kitchen table which for the record is full of random mushrooms and projects, which is not ideal when your trying to amplify small amounts of DNA. I cleared off a small two foot diameter space and cleaned it with a 10% bleach solution followed by a 70% isopropanol solution. I washed my hands thoroughly with soap and water and sprayed them with 70% isopropanol to make them dry quicker and because I didn't have gloves. I extracted one Mycena cap from the collection bag and placed it in a clean petri dish. I washed the cap gently in distilled water to remove any accidental materials that may have been attached to the sample in the field or in the drying process. The small cap was then added to clean 1.5mL centrifuge tube and crushed with a pipette tip for 30 seconds until the mushroom was a puree. 1µl of the liquid was transferred to PCR tube and placed on the thermalcyler for 5 minutes at 95C in hopes of further disrupting any cells that might be in solution to let their DNA out. I then added 2µl of my fungal primer mix with 10 ul of MasterMix (polymerase, dntps, Mg++, buffers) and 8µl of distilled water. I made sure to mix the the vial well and then flicked it down before putting it on the Thermalcycler for the PCR run. The run took a little less then an hour. 2µl of loading dye were added to 10ul of the PCR product and loaded on a 2% agarose gels using SYBR Green to stain.
Sequencing and Analysis
Since the agarose gel showed a band in the size range expected for the ITS1 region covered by our primers (~700 bp) it can be concluded that the amplification was successful and the sample could be sent off for sequencing. I sent the sample out for Sanger Sequencing with PCR clean up and the first set of traces they sent back where in rough condition so they automatically adjusted their sequencer for a longer load time and the second set of trace files was much better. I used the free software SeqTrace to align the traces, remove M13 sequence primers, and also edit for mis-called bases. The final consensus sequence is here:
ATTAAATTGTCCCTTGCGAGACGGTTATAAGCAGGTTCCCATAATTTTGCTTCACAGTCAAATGGCATAGATAATTATCACACCAAGTGACGGTCCACAANAGATCCCACTAATGCATTTAAAGGGAGCAGACCNTCCACTGAAGGAAGCCAGCAAGCCCTCACATCCAAGCCTCGCTCAAGCTCGTAAAAGCGAACAAGGTTGATAATTTAATGACACTCAAACAGGCATGCCCTTCGGAATACCAAAGGGCGCAAGGTGCGTTCAAAGATTCNATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTNTTCATCGATGGGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATAGGTTTAATGACTGCGACCAAGCACAATCCTTAAAGACATTCTGTAACATTGTATAGGGTATATGAAAACGTAGCCTTGAAAAAAGCAAAAGCAGGGGAAGTGCTGACGCTCAACCCCCAAACCGCAGTCACCACGAAGTAAATCGCAGCAACGCGCATAAACAGAGGAAGGGCTGTTACACCCAATCCCCCAAACCGCAGCCACCGCGAAGTTAATCACAGCAGCGCGAAATTCACTTGTTCCAAAGGANCTACAAAATGTGCACAAGAGAAGGTTAAATATGAACGGACGAGCACATGCCCAGTGAAGAGCCAGCATCAGAACCGATTCAGTATTCAATAATGATCCTTC
Using BLAST to compare the above sequence to GenBank it is obvious that this is a Mycena sequence. E-values of zero for all of the top Mycena hits. I found a voucher specimen for Mycena leptocephala in Genbank from University of British Columbia (HQ604773.1). When I run a comparison of the sequences BLAST returns an E-value of 0.0 and an identity match 598/616(97%). I looked at a few of the mismatch locations and some of them are true mis-matches, but a few could be basecalling errors. I'll dig more into this at a later time.
Below are some basic images from the low level BioInformatics that was done to get the above sequence
Sequence was submitted to GenBank via BankIt and has submission number SUB3217715 associated with it. Submission to GenBank contains a link to the iNaturalist observation and vice versa. iNaturalist observation was updated with field "DNA Barcode ITS" and the tag "BarcodeTheLake-barcoded" was applied.
https://www.inaturalist.org/observations/5036264
https://www.ncbi.nlm.nih.gov/nuccore/MG518323
Next Steps
Optimize the PCR cycling for the fungal primers
Build a standard operating procedure (SOP) for the above process that lives online.
Finalize location for Barcode the Lake lab work to be done and get participants in the door to work on specimens,
Continue to work on funding